View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13349_low_6 (Length: 279)
Name: NF13349_low_6
Description: NF13349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13349_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 991209 - 990948
Alignment:
| Q |
1 |
ttgcattgttgattgtgttatgtgtaacagttttatacgaataagaaaaggaaagcgatttcaccggctccaaaggcggggagaatagagaaaggtgcaa |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| | ||||||||||||||||||||| |||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
991209 |
ttgcattgttgattttgttatgtgtaacagttttatactactaagaaaaggaaagcgatttctccggctccgaaggcggggagaatagagaaagttgcaa |
991110 |
T |
|
| Q |
101 |
ggattgtggctgatggatctccaagtgcaaaaggatcattggaaggttacttggttccatcgcaggaggatccggtgaggccggatttggttagaaggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
991109 |
ggattgtggctgatggatctccaagtgcgaaaggatcattggaaggttacttggttccatcgcaggaggatccggtgaggccggatttggttagaaggaa |
991010 |
T |
|
| Q |
201 |
attgggattagacattggtagttctcttgataagcagcctgtttcattagctcaagagattc |
262 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
991009 |
attgggattagacattggtggttctcttgataagcagcctgtttcattagctcaagagattc |
990948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University