View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13349_low_7 (Length: 247)
Name: NF13349_low_7
Description: NF13349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13349_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 67 - 198
Target Start/End: Complemental strand, 991403 - 991272
Alignment:
| Q |
67 |
catgtcctctccttcccctcgtaatcgcctcaatcaggtccttctctatccccatttccacttcccccaaaccctagaatttcgcattatagggtaacga |
166 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
991403 |
catgtcctctccttcccctcgcaatcgcctcaatcaggtccttctctatccccatttccacttcccccaaaccctagaatttcgcattctagggtaacga |
991304 |
T |
 |
| Q |
167 |
ttattgaagtattcaattctccaatgtcgctg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
991303 |
ttattgaagtattcaattctccaatgtcgctg |
991272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University