View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1334_high_22 (Length: 320)
Name: NF1334_high_22
Description: NF1334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1334_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 89; Significance: 7e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 199 - 291
Target Start/End: Original strand, 29392969 - 29393061
Alignment:
| Q |
199 |
cttcgactctcttcaaatttccacctcctgtatcaaattatatttatttatttaagaaatttgtgattttcgtaaaagcaataatagggtatc |
291 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29392969 |
cttcgactctcttcaaattttcacctcctgtatcaaattatatttatttatttaagaaatttgtgattttcgtaaaagcaataatagggtatc |
29393061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University