View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1334_high_28 (Length: 258)
Name: NF1334_high_28
Description: NF1334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1334_high_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 124 - 248
Target Start/End: Original strand, 11402851 - 11402976
Alignment:
| Q |
124 |
gtggaattttcaagtctttgtcatgaccgcaaa-tggtctcaaatgatttttccaaatcatgacctctttatctccttttttgaggaaatgacctcttat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11402851 |
gtggaattttcaagtctttgtcatgaccgcaaaatggtctcaaatgatttttccaaatcatgacctctttatctccttttttgaggaaatgacctcttat |
11402950 |
T |
 |
| Q |
223 |
ctcatactcatatggtgtgttctctg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
11402951 |
ctcatactcatatggtgtgttctctg |
11402976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University