View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1334_low_22 (Length: 363)
Name: NF1334_low_22
Description: NF1334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1334_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 51 - 350
Target Start/End: Complemental strand, 41033769 - 41033470
Alignment:
| Q |
51 |
gggttaagtggttagtgtcacatcagctagaaatgagctaatgtcttcaaaactttgggtggtgagtagcgtttaagtcttttgttggatcttatcactt |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
41033769 |
gggttaagtggttagtgtcacatcagctagaaatgagctaatgtcttaaaaattttgggtggtgagcagcgtttaagttttttgttggatcttatcactt |
41033670 |
T |
 |
| Q |
151 |
acctcgttgttgctcctggcgctctccaaactctataacacaaccaaccattatgtctgaccatttctcgatctgcataatttgattttaatcgtacaac |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41033669 |
acctcgttgttgctcctggcgctctccaaactctataacacaaccaaccattatgtctgaccacttctcgatctgcataatttgattttaatcgtacaac |
41033570 |
T |
 |
| Q |
251 |
atgatgtaaaagttgtctgcggtcttttacatattgatcctagacccacaacaacgggtcaaatttggcacgaacccaattcgaacttattgagctagaa |
350 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41033569 |
atgatgtaaaagttgtctgcggtcttttgcatactgatcctagacccacaacaacgggtcaaatttggcacaaacccaattcgaacttattgagctagaa |
41033470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University