View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1334_low_34 (Length: 305)
Name: NF1334_low_34
Description: NF1334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1334_low_34 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 7e-86; HSPs: 7)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 1 - 161
Target Start/End: Original strand, 2350239 - 2350399
Alignment:
| Q |
1 |
ccatactctcgcccaccacgctctcgttcaaaactcagccatcttctctgatcgccctagagctcttcccaccgccaaaatcatctccagcaaccaacac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2350239 |
ccatactctcgcccaccacgctctcgttcaaaactcagccatcttctctgatcgccctagagctcttcccaccgccaaaatcatctccagcaaccaacac |
2350338 |
T |
|
| Q |
101 |
aacatcagctccgctttttatggtgcaacatggcgtgccctccgtcgaaaccttgcttctg |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2350339 |
aacatcagctccgctttttatggtgcaacatggcgtgccctccgtcgaaaccttgcttctg |
2350399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 2293050 - 2293208
Alignment:
| Q |
1 |
ccatactctcgcccaccacgctctcgttcaaaactcagccatcttctctgatcgccctagagctcttcccaccgccaaaatcatctccagcaaccaacac |
100 |
Q |
| |
|
||||||||| |||||||| | |||||||||||||||| ||||||||||||||||||||| ||||||||| || ||||||| | ||||||||||||||| |
|
|
| T |
2293050 |
ccatactctggcccaccatgttctcgttcaaaactcatccatcttctctgatcgccctacagctcttcctacttccaaaatgttgtccagcaaccaacac |
2293149 |
T |
|
| Q |
101 |
aacatcagctccgctttttatggtgcaacatggcgtgccctccgtcgaaaccttgcttc |
159 |
Q |
| |
|
||||||| | |||||| |||||| ||||||||||| |||| ||||| ||||||||||| |
|
|
| T |
2293150 |
aacatcaacaccgcttattatggcccaacatggcgtacccttcgtcgtaaccttgcttc |
2293208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 2302669 - 2302827
Alignment:
| Q |
1 |
ccatactctcgcccaccacgctctcgttcaaaactcagccatcttctctgatcgccctagagctcttcccaccgccaaaatcatctccagcaaccaacac |
100 |
Q |
| |
|
|||| |||| |||||||| | ||||||||||||||||| ||||| |||||||||||||| |||| |||| || ||||||| | ||||||||||||||| |
|
|
| T |
2302669 |
ccatgctctggcccaccatgttctcgttcaaaactcagacatctactctgatcgccctaaagcttttcctacttccaaaatgttgtccagcaaccaacac |
2302768 |
T |
|
| Q |
101 |
aacatcagctccgctttttatggtgcaacatggcgtgccctccgtcgaaaccttgcttc |
159 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||| |||||||||| ||||||||||| |
|
|
| T |
2302769 |
aacatcagctccggtttttatggcccaacatggcgtaccctccgtcgtaaccttgcttc |
2302827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 2320370 - 2320528
Alignment:
| Q |
1 |
ccatactctcgcccaccacgctctcgttcaaaactcagccatcttctctgatcgccctagagctcttcccaccgccaaaatcatctccagcaaccaacac |
100 |
Q |
| |
|
|||| |||| || ||||| | ||||||||||||||||||||||||||| |||||||| ||||||||| || ||| ||| | ||||||||||||||| |
|
|
| T |
2320370 |
ccatgctctggctcaccatgttctcgttcaaaactcagccatcttctcggatcgccccgtagctcttcctacttccataatgttgtccagcaaccaacac |
2320469 |
T |
|
| Q |
101 |
aacatcagctccgctttttatggtgcaacatggcgtgccctccgtcgaaaccttgcttc |
159 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||||| |
|
|
| T |
2320470 |
aacatcagctccgctttttatggcccaacatggcgtaccctccgtcgtaaccttgcttc |
2320528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 2309381 - 2309538
Alignment:
| Q |
1 |
ccatactctcgcccaccacgctctcgttcaaaactcagccatcttctctgatcgccctagagctcttcccaccgccaaaatcatctccagcaaccaacac |
100 |
Q |
| |
|
|||| |||| || ||||| | ||||||||||||||||||||| ||||||||||||||| ||||||||| || ||||||| | ||||||||||||||| |
|
|
| T |
2309381 |
ccatgctctggctcaccatgttctcgttcaaaactcagccataatctctgatcgccctacagctcttcctacttccaaaatgttgtccagcaaccaacac |
2309480 |
T |
|
| Q |
101 |
aacatcagctccgctttttatggtgcaacatggcgtgccctccgtcgaaaccttgctt |
158 |
Q |
| |
|
||||||| | ||||||||||||| ||||||||||| |||||||||| |||||||||| |
|
|
| T |
2309481 |
aacatcaacaccgctttttatggcccaacatggcgtaccctccgtcgtaaccttgctt |
2309538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 6 - 153
Target Start/End: Original strand, 2329944 - 2330091
Alignment:
| Q |
6 |
ctctcgcccaccacgctctcgttcaaaactcagccatcttctctgatcgccctagagctcttcccaccgccaaaatcatctccagcaaccaacacaacat |
105 |
Q |
| |
|
|||| |||||||||||||||||||||||||| || ||||||||||||| |||| ||| |||||||| |||| |||| ||||||||||| ||||| || |
|
|
| T |
2329944 |
ctctggcccaccacgctctcgttcaaaactcctccgtcttctctgatcgtcctaaagcacttcccactaacaaactcatgtccagcaaccagcacaatat |
2330043 |
T |
|
| Q |
106 |
cagctccgctttttatggtgcaacatggcgtgccctccgtcgaaacct |
153 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | |||||||| ||||| |
|
|
| T |
2330044 |
cagctccgctttttatggaccaacatggcgtactctccgtcgtaacct |
2330091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 6 - 153
Target Start/End: Original strand, 2326229 - 2326376
Alignment:
| Q |
6 |
ctctcgcccaccacgctctcgttcaaaactcagccatcttctctgatcgccctagagctcttcccaccgccaaaatcatctccagcaaccaacacaacat |
105 |
Q |
| |
|
|||| ||||||||||| ||||||||||| ||| | ||||||| ||||| |||| ||| ||||||| |||| |||| || |||||||| |||||||| |
|
|
| T |
2326229 |
ctctggcccaccacgccctcgttcaaaattcatctctcttctccgatcgtcctaaagcacttcccagtcacaaactcatatctagcaaccagcacaacat |
2326328 |
T |
|
| Q |
106 |
cagctccgctttttatggtgcaacatggcgtgccctccgtcgaaacct |
153 |
Q |
| |
|
|||| ||||||||||||| |||||||| || |||||||||| ||||| |
|
|
| T |
2326329 |
cagcgccgctttttatggcccaacatggtgtaccctccgtcgtaacct |
2326376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 254 - 305
Target Start/End: Original strand, 4664901 - 4664952
Alignment:
| Q |
254 |
acaagatacttcacaccaaaaagaagaaacactacgtgcatattaattataa |
305 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4664901 |
acaagttacttcacaccaaaaagaagaaacactacgtgcatattaattataa |
4664952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University