View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1334_low_43 (Length: 252)
Name: NF1334_low_43
Description: NF1334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1334_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 37 - 156
Target Start/End: Original strand, 11402853 - 11402973
Alignment:
| Q |
37 |
ggaattttcaagtctttgtcattaccgcaaa-tggtctcaaatgatttttccaaatcattacctctttatctccttttttgaggaaatgacctcttatct |
135 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11402853 |
ggaattttcaagtctttgtcatgaccgcaaaatggtctcaaatgatttttccaaatcatgacctctttatctccttttttgaggaaatgacctcttatct |
11402952 |
T |
 |
| Q |
136 |
catactcatatggtgtgttct |
156 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
11402953 |
catactcatatggtgtgttct |
11402973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University