View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13350_high_1 (Length: 235)
Name: NF13350_high_1
Description: NF13350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13350_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 10 - 220
Target Start/End: Original strand, 10795898 - 10796108
Alignment:
| Q |
10 |
aagcaaagattgtcagaacaaaagctaaagtacgacattaagcagattataggaatgaaaaagaatgaatgatgaagattggctcaaactgatttattaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| ||||| ||||| |
|
|
| T |
10795898 |
aagcaaagattgtcagaacaaaagctaaagtacgacatttagcagattataggaatgaaaaagaatgaatgatgaagattggctaaaaatgattcattaa |
10795997 |
T |
 |
| Q |
110 |
tcgatagagctgacataaaaagtttcacattatggatgtcagcatcgaaggaaccaagtttgttagcggtcagtttctaatgcgcataaaatgcttatta |
209 |
Q |
| |
|
| |||||||||||||||||||||| |||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10795998 |
tagatagagctgacataaaaagttccacattttgcatgtcagcatctaaggaaccaagtttgttagcggtcagtttctaatgcgcataaaatgcttatta |
10796097 |
T |
 |
| Q |
210 |
taacaactttg |
220 |
Q |
| |
|
||||||||||| |
|
|
| T |
10796098 |
taacaactttg |
10796108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University