View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13351_high_12 (Length: 264)
Name: NF13351_high_12
Description: NF13351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13351_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 20 - 253
Target Start/End: Complemental strand, 52860559 - 52860326
Alignment:
| Q |
20 |
agctgtgagagattagagagtgatgaagatattgaaccagtgagttgaagacgaggtaaacgtatagtgtgaactctgttattgttgttgtaacagagaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52860559 |
agctgtgagagattagagagtgatgaagatattgaaccagtgagttgaagacgaggtaaacgtatagtgtgaactctgttattgttgttgtaacagagaa |
52860460 |
T |
|
| Q |
120 |
tgccatgccaatcacatggtgctgaaggtgttgatggatcccaagttgttaaggcattgagtgggtcaagaaggtttagtttgaagattgttaaggcttg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52860459 |
tgccatgccaatcacatggtgctgaaggtgttgatggatcccaagttgttaaggcattgagtgggtcaagaaggtttagtttgaagattgttaaggcttg |
52860360 |
T |
|
| Q |
220 |
gatttcggaatgagatgagttgatctgtgctgct |
253 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||| |
|
|
| T |
52860359 |
gatttcggaatgagatgagttgatttgtgttgct |
52860326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University