View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13351_low_16 (Length: 236)
Name: NF13351_low_16
Description: NF13351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13351_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 14 - 219
Target Start/End: Complemental strand, 8202199 - 8201994
Alignment:
| Q |
14 |
tagcaaaggtaaagtttttgccattaaatttgcttgcatgtttattaaatagcttttcctgttgaggttttgagcaattgtactgttcattctcttgcag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8202199 |
tagcaaaggtaaagtttttgccattaaatttgcttgcatgtttattaaatagcttttcctgttgaggttttgagcaattgtactgttcattctcttgcag |
8202100 |
T |
 |
| Q |
114 |
ttggttggcatgcgacctcttgagaggtcactggagaaacttgatgatgttagaaagaaaaagctttcagaaatgatttcaggttctgaagatgctgtgc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8202099 |
ttggttggcatgcgacctcttgagaggtcactggagaaacttgatgatgttagaaagaaaaagctttcagaaatgatttcaggttctgaagatgctgtgc |
8202000 |
T |
 |
| Q |
214 |
ctggtg |
219 |
Q |
| |
|
|||||| |
|
|
| T |
8201999 |
ctggtg |
8201994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 28 - 219
Target Start/End: Complemental strand, 42359188 - 42358997
Alignment:
| Q |
28 |
tttttgccattaaatttgcttgcatgtttattaaatagcttttcctgttgaggttttgagcaattgtactgttcattctcttgcagttggttggcatgcg |
127 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||| || |||||| || ||||||||||||||||||||| | |||||||| |||||| |||||||||| | |
|
|
| T |
42359188 |
ttttttccattaaatttgcatgcatgtttattagattgcttttgctattgaggttttgagcaattgtaatcttcattcttctgcagtcggttggcatgag |
42359089 |
T |
 |
| Q |
128 |
acctcttgagaggtcactggagaaacttgatgatgttagaaagaaaaagctttcagaaatgatttcaggttctgaagatgctgtgcctggtg |
219 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42359088 |
acctctagagaggtcactggagaaacttgatgatgttagaaggaaaaagctttcagaaatgatttcaggttctgaagatgctgtgcccggtg |
42358997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University