View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13352_low_2 (Length: 408)
Name: NF13352_low_2
Description: NF13352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13352_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 71; Significance: 5e-32; HSPs: 7)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 179 - 265
Target Start/End: Complemental strand, 6652214 - 6652128
Alignment:
| Q |
179 |
ttcttctgtttgattgattatctccctgttatttgttatgtttggcagcttttctctattcgctcttctttttggttacctttcccc |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6652214 |
ttcttctgtttgattgattatctccctgttaattgttatgtttggttgcttttctctattcgctcttctttttggttgcctttcccc |
6652128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 179 - 265
Target Start/End: Complemental strand, 6732614 - 6732528
Alignment:
| Q |
179 |
ttcttctgtttgattgattatctccctgttatttgttatgtttggcagcttttctctattcgctcttctttttggttacctttcccc |
265 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6732614 |
ttcttctgtttgattgattatctcactgttaattgttatgtttggttgcttttctctattcgctcttctttttggttgcctttcccc |
6732528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 20 - 91
Target Start/End: Complemental strand, 6652333 - 6652264
Alignment:
| Q |
20 |
cttgcaacggccaagctccccatttcaagttgagaaacagcacggcatatactgtaaccaaagcttccacag |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6652333 |
cttgcaacggccaagctccccatttcaagttgagaaacagcacggc--atactgtaaccaaagcttccacag |
6652264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 20 - 91
Target Start/End: Complemental strand, 6566880 - 6566811
Alignment:
| Q |
20 |
cttgcaacggccaagctccccatttcaagttgagaaacagcacggcatatactgtaaccaaagcttccacag |
91 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6566880 |
cttgcaactgccaagctccccatttcaagttgagaaacagcacggc--atactgtaaccaaagcttccacag |
6566811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 20 - 91
Target Start/End: Complemental strand, 6732733 - 6732664
Alignment:
| Q |
20 |
cttgcaacggccaagctccccatttcaagttgagaaacagcacggcatatactgtaaccaaagcttccacag |
91 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6732733 |
cttgcaacagccaagctccccatttcaagttgagaaacagcacggc--atactgtaaccaaagcttccacag |
6732664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 331 - 370
Target Start/End: Complemental strand, 6652068 - 6652029
Alignment:
| Q |
331 |
tagtttatatttttggtttcccttggtctgatttggtttg |
370 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
6652068 |
tagtttatatttttggtttccattggcctgatttggtttg |
6652029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 331 - 370
Target Start/End: Complemental strand, 6732468 - 6732429
Alignment:
| Q |
331 |
tagtttatatttttggtttcccttggtctgatttggtttg |
370 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
6732468 |
tagtttatatttttggtttccattggcctgatttggtttg |
6732429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University