View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13354_high_14 (Length: 228)
Name: NF13354_high_14
Description: NF13354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13354_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 21 - 212
Target Start/End: Complemental strand, 52393468 - 52393277
Alignment:
| Q |
21 |
tgtgggccattagttttccaaaacttaagattannnnnnn-aagtatagaataggtggaaccctttgggagagtgaacctctcccgtgaaggatattttg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52393468 |
tgtgggccattagttttccaaaacttaagattatttcttttaagtatagtataggtggaaccctttgggagagtgaacctt--ccgtgaaggatattttg |
52393371 |
T |
|
| Q |
120 |
acagtttaggacacctgccaaatattcatcttcaaattttttgaaggagatttgctcacctttaaaacaagg-tttaggcagctgcgacgtaga |
212 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52393370 |
acagtctaggacatctgccaaatattcatcttcaaattttttgaaggagatttgctcacctttaaaacaaggttttaggcagctgcgacgtaga |
52393277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 76 - 199
Target Start/End: Original strand, 39280799 - 39280920
Alignment:
| Q |
76 |
ggaaccctttgggagagtgaacctctcccgtgaaggatattttgacagtttaggacacctgccaaatattcatcttcaaattttttgaaggagatttgct |
175 |
Q |
| |
|
|||||||||| ||||||||| |||| |||||||||| ||||||||||| || ||||| ||||||||||| |||| | | |||||| |||||||||| |
|
|
| T |
39280799 |
ggaaccctttaggagagtgagcctc--ccgtgaaggacattttgacagtctaagacacttgccaaatatttgtctttagaaattttgatcgagatttgct |
39280896 |
T |
|
| Q |
176 |
cacctttaaaacaaggtttaggca |
199 |
Q |
| |
|
||||||| |||||||||||||| |
|
|
| T |
39280897 |
cacctttttgacaaggtttaggca |
39280920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 114 - 206
Target Start/End: Original strand, 4777827 - 4777919
Alignment:
| Q |
114 |
attttgacagtttaggacacctgccaaatattcatcttcaaattttttgaaggagatttgctcacctttaaaacaaggtttaggcagctgcga |
206 |
Q |
| |
|
||||||| |||||| |||||| ||||||| | ||||||| | |||||| ||||||||||||||||| ||||| |||||||| |||||||| |
|
|
| T |
4777827 |
attttgaaagtttaaaacacctaccaaataataatcttcagagattttgatagagatttgctcacctttcaaacacggtttaggtagctgcga |
4777919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 114 - 206
Target Start/End: Complemental strand, 16059357 - 16059265
Alignment:
| Q |
114 |
attttgacagtttaggacacctgccaaatattcatcttcaaattttttgaaggagatttgctcacctttaaaacaaggtttaggcagctgcga |
206 |
Q |
| |
|
||||||||||| || ||||||| | |||| | ||||||| | |||||| ||||||| ||||||||| ||||| ||||||||||||||||| |
|
|
| T |
16059357 |
attttgacagtctaaaacacctgtcgaataatgatcttcagagattttgatcgagattttctcacctttcaaacatggtttaggcagctgcga |
16059265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 166 - 206
Target Start/End: Complemental strand, 42996584 - 42996544
Alignment:
| Q |
166 |
gagatttgctcacctttaaaacaaggtttaggcagctgcga |
206 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
42996584 |
gagatttgctcacctttgaaacacggtttaggcagctgcga |
42996544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University