View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13354_high_15 (Length: 226)
Name: NF13354_high_15
Description: NF13354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13354_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 30 - 211
Target Start/End: Complemental strand, 36205096 - 36204905
Alignment:
| Q |
30 |
tttggaatcacaatgaatttgaaaaaatcacggtgacacacact--gaaactattgtataaaattgcacgaaactaacaactgtcaaataactctcatat |
127 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
36205096 |
tttggaatcacaatgagtttgaaaaaatcacgatgacacacactatgaaactattgtataaaattgcacgaaactatcaactgtcaaaagactctcatat |
36204997 |
T |
 |
| Q |
128 |
catggaggtactgtcaagctattgtactga--------aattagatcactataattcatgaaatcttttagttagatagattttgcagatac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
36204996 |
catggaggtactgtcaagctattgtactgaataccattaattagatcactataattcatgaaatcttttagttacaaagattttgcagatac |
36204905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University