View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13354_low_10 (Length: 298)
Name: NF13354_low_10
Description: NF13354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13354_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 38 - 288
Target Start/End: Original strand, 3542641 - 3542891
Alignment:
| Q |
38 |
aacacaaccttttcttcttaaaaaccaatcaattcattcattatcttccaacacaacacaaacacagaacaaaacatcatcaaaccttgccgttgatgga |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3542641 |
aacacaaccttttcttcttaaaaaccaatcaattcattcattatcttccaacacaacacaaacacagaacaaaacatcatcaaaccttgccgttgatgga |
3542740 |
T |
|
| Q |
138 |
aaattgtcttacgatcaaacctcacataggattcttcacaagacctannnnnnnnncttcttctttgagttttaggagcagagtacccttgataaaggct |
237 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3542741 |
aaattgtcttacaatcaaacctcacataggattcttcacaagacctatttctttttcttcttctttgagttttaggagcagagtacccttgataaaggct |
3542840 |
T |
|
| Q |
238 |
agtgctggagctagtagtcactgtgagtctagtagtttgaacacacctttg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3542841 |
agtgctggagctagtagtcactgtgagtctagtagtttgaacacacctttg |
3542891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University