View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13354_low_12 (Length: 238)
Name: NF13354_low_12
Description: NF13354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13354_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 45744212 - 45743978
Alignment:
| Q |
1 |
ccaagctggtcgaagaagcatgttgaagctggcacaacgtatgaccaacaacttctgttccggggtttgtgcttcatctgctagaaaatgggacagcctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45744212 |
ccaagctggtcgaagaagcatgttgaagctggcacaacgtatgaccaacaacttctgttccggggtttgtgcttcatctgctagaaaatgggacagcctc |
45744113 |
T |
 |
| Q |
101 |
caaatggggactctgagtgatgacatgagagttatgactaggaaaaatgttgatgaccctggcgagcctcccggtattgtgctcagcgctgcaacatctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45744112 |
caaatggggactctgagtgatgacatgagagttatgactaggaaaaatgttgatgaccctggcgagcctcccggtattgtgctcagcgctgcaacatctg |
45744013 |
T |
 |
| Q |
201 |
tttggatgcccgtttcacgacaaagactgtttgat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45744012 |
tttggatgcccgtttcacgacaaagactgtttgat |
45743978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 72
Target Start/End: Complemental strand, 12323213 - 12323156
Alignment:
| Q |
15 |
gaagcatgttgaagctggcacaacgtatgaccaacaacttctgttccggggtttgtgc |
72 |
Q |
| |
|
|||||||| ||||||| |||||||| ||||| |||||||||||| |||| || ||||| |
|
|
| T |
12323213 |
gaagcatgctgaagcttgcacaacgaatgactaacaacttctgtgccggtgtctgtgc |
12323156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University