View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13354_low_16 (Length: 218)
Name: NF13354_low_16
Description: NF13354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13354_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 3 - 110
Target Start/End: Complemental strand, 45908962 - 45908855
Alignment:
| Q |
3 |
atatatgttcgatttaattctaaagtgtcgatactacgtagtagccaaaccttcatatggtatggtattattacaaagaaagatttaagtctaagctatt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45908962 |
atatatgttcgatttaattctaaagtgtcgatactacgtagtagccaaaccttcatatggtatggtattattacaaagaaagatttaagtctaagctatt |
45908863 |
T |
 |
| Q |
103 |
atcacttg |
110 |
Q |
| |
|
|||||||| |
|
|
| T |
45908862 |
atcacttg |
45908855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 146 - 201
Target Start/End: Complemental strand, 45908819 - 45908764
Alignment:
| Q |
146 |
ggtgtcactgttgtagtggttgcacttgcagctacttcttcttgcacatattcttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45908819 |
ggtgtcactgttgtagtggttgcacttgcagctacttcttcttgcacatattcttt |
45908764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University