View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13354_low_17 (Length: 214)
Name: NF13354_low_17
Description: NF13354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13354_low_17 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
| [»] scaffold0198 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 45744490 - 45744277
Alignment:
| Q |
1 |
cacttggattgagcactgggagtatgatgagagtattgttcaccaactctatcgtccgttgctcatttccggttttggatttggcgctcatagatggatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45744490 |
cacttggattgagcactgggagtatgatgagagtattgttcaccaactctatcgtccgttgctcatttccggttttggatttggcgctcatagatggatc |
45744391 |
T |
 |
| Q |
101 |
gccaccctccaaaggcagtgtgaaggcttggctatcctcatgtcctcttccatctcaaatgatgatcacaccggtaaaacaaatcacatgcatgaattta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45744390 |
gccaccctccaaaggcagtgtgaaggcttggctatcctcatgtcctcttccatctcaaatgatgatcacaccggtaaaacaaatcacatgcatgaattta |
45744291 |
T |
 |
| Q |
201 |
aatcgttatatttt |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
45744290 |
aatcgttatatttt |
45744277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0198 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0198
Description:
Target: scaffold0198; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 123
Target Start/End: Complemental strand, 7697 - 7597
Alignment:
| Q |
23 |
tatgatgagagtattgttcaccaactctatcgtccgttgctcatttccggttttggatttggcgctcatagatggatcgccaccctccaaaggcagtgtg |
122 |
Q |
| |
|
|||||||||||| |||| |||||| ||||||||| ||| | | |||||| | | |||||| |||||||||||| | || || ||||| |||||||||| |
|
|
| T |
7697 |
tatgatgagagtgttgtccaccaagcctatcgtccattggttaattccggcatggcatttggtgctcatagatgggttgcaactctccagaggcagtgtg |
7598 |
T |
 |
| Q |
123 |
a |
123 |
Q |
| |
|
| |
|
|
| T |
7597 |
a |
7597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University