View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13356_low_3 (Length: 601)
Name: NF13356_low_3
Description: NF13356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13356_low_3 |
 |  |
|
| [»] scaffold0306 (1 HSPs) |
 |  |  |
|
| [»] scaffold0302 (1 HSPs) |
 |  |  |
|
| [»] scaffold0152 (1 HSPs) |
 |  |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 7)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 232
Target Start/End: Complemental strand, 7410100 - 7409888
Alignment:
| Q |
19 |
aatttgagttatatgtttactaacaatattttcacgactttcaaagtatggattgtattgaaacaaactctcataattagcctttatcattttagattat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7410100 |
aatttgagttatatgtttactaacaatattttcacgactttcaaagtatggattgtattgaaacaaactctcataattagcctttatcattttagattat |
7410001 |
T |
 |
| Q |
119 |
ttataattaaataaaatattgtgcaatcaagtaattgagctcaagctagtggttaatgaattttaacaatgacgaattattatctcaatcttaaaaaata |
218 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||| |
|
|
| T |
7410000 |
ttataattaaataaaatattgtgcgatcaagtaattgagctcaagctagtggttaatgaattttaccaatgacgaattattatctcaat-tttaaaaata |
7409902 |
T |
 |
| Q |
219 |
tttgctaccaaaaa |
232 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7409901 |
tttgctaccaaaaa |
7409888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 412 - 450
Target Start/End: Original strand, 794955 - 794993
Alignment:
| Q |
412 |
gtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
794955 |
gtcttcttctcacaatagttatccttttacatgttttag |
794993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 411 - 450
Target Start/End: Original strand, 18808819 - 18808858
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18808819 |
agtcttcttctcacaatagttatccttttatatgttttag |
18808858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 411 - 448
Target Start/End: Original strand, 1585901 - 1585938
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgtttt |
448 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1585901 |
agtcttcttcttacaatagttatccttttacatgtttt |
1585938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 416 - 450
Target Start/End: Complemental strand, 7409866 - 7409832
Alignment:
| Q |
416 |
tcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
7409866 |
tcttctcataatagttatccttttacatgttttag |
7409832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 416 - 449
Target Start/End: Complemental strand, 26653983 - 26653950
Alignment:
| Q |
416 |
tcttctcacaatagttatccttttacatgtttta |
449 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
26653983 |
tcttctcacaatggttatccttttacatgtttta |
26653950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 416 - 448
Target Start/End: Complemental strand, 24909551 - 24909519
Alignment:
| Q |
416 |
tcttctcacaatagttatccttttacatgtttt |
448 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
24909551 |
tcttctcacaatagttatccttttacatatttt |
24909519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 411 - 450
Target Start/End: Original strand, 21555421 - 21555460
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21555421 |
agtcttcttctcacaatagttatccttttacatgttttag |
21555460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 416 - 450
Target Start/End: Original strand, 23249516 - 23249550
Alignment:
| Q |
416 |
tcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
23249516 |
tcttctcacaatagttatccttttacatgttttag |
23249550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 416 - 450
Target Start/End: Original strand, 27733422 - 27733456
Alignment:
| Q |
416 |
tcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
27733422 |
tcttctcacaatagttatccttttacatgttttag |
27733456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 416 - 450
Target Start/End: Complemental strand, 36609456 - 36609422
Alignment:
| Q |
416 |
tcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
36609456 |
tcttctcacaatagttatccttttacatgttttag |
36609422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Original strand, 827870 - 827909
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
827870 |
agtcctcttctcacaatagttatctttttacatgttttag |
827909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Original strand, 12701079 - 12701118
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
12701079 |
agtcttcttcttacaatagttattcttttacatgttttag |
12701118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 56100186 - 56100147
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
56100186 |
agtcctcttctcgcaatagttatccttttacatgttttag |
56100147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000004; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 413 - 450
Target Start/End: Original strand, 41326084 - 41326121
Alignment:
| Q |
413 |
tcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41326084 |
tcttcttctcacaatagttatccttttacatgttttag |
41326121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 40337114 - 40337075
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40337114 |
agtcatcttctcacaatagttatcattttacatgttttag |
40337075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 416 - 450
Target Start/End: Complemental strand, 8163686 - 8163652
Alignment:
| Q |
416 |
tcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8163686 |
tcttctcacaatagttatctttttacatgttttag |
8163652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0306 (Bit Score: 36; Significance: 0.00000000006; HSPs: 1)
Name: scaffold0306
Description:
Target: scaffold0306; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 13104 - 13065
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13104 |
agtcctcttctcacaatagttatccttttacatgttttag |
13065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0302 (Bit Score: 36; Significance: 0.00000000006; HSPs: 1)
Name: scaffold0302
Description:
Target: scaffold0302; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 18551 - 18512
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18551 |
agtcatcttctcacaatagttatccttttacatgttttag |
18512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0152 (Bit Score: 36; Significance: 0.00000000006; HSPs: 1)
Name: scaffold0152
Description:
Target: scaffold0152; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 411 - 450
Target Start/End: Original strand, 22223 - 22262
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22223 |
agtcctcttctcacaatagttatccttttacatgttttag |
22262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000006; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 4623898 - 4623859
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4623898 |
agtcatcttctcacaatagttatccttttacatgttttag |
4623859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 411 - 450
Target Start/End: Original strand, 23403639 - 23403678
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23403639 |
agtcctcttctcacaatagttatccttttacatgttttag |
23403678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 30204696 - 30204657
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30204696 |
agtcatcttctcacaatagttatccttttacatgttttag |
30204657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 36470183 - 36470144
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36470183 |
agtcatcttctcacaatagttatccttttacatgttttag |
36470144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 414 - 450
Target Start/End: Original strand, 16656022 - 16656058
Alignment:
| Q |
414 |
cttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16656022 |
cttcttctcacaatagttatcattttacatgttttag |
16656058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 421 - 450
Target Start/End: Complemental strand, 36046567 - 36046538
Alignment:
| Q |
421 |
tcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36046567 |
tcacaatagttatccttttacatgttttag |
36046538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000006; HSPs: 8)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 36404270 - 36404231
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36404270 |
agtcctcttctcacaatagttatccttttacatgttttag |
36404231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 416 - 450
Target Start/End: Original strand, 47599410 - 47599444
Alignment:
| Q |
416 |
tcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
47599410 |
tcttctcacaatagttatccttttacatgttttag |
47599444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 16353537 - 16353498
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
16353537 |
agtcctcttttcacaatagttatccttttacatgttttag |
16353498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Original strand, 29360523 - 29360562
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
29360523 |
agtcctcttctcacagtagttatccttttacatgttttag |
29360562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Original strand, 35534523 - 35534562
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
35534523 |
agtcttcttctcacaatagttatcattttatatgttttag |
35534562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 415 - 450
Target Start/End: Original strand, 39392002 - 39392037
Alignment:
| Q |
415 |
ttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39392002 |
ttcttttcacaatagttatccttttacatgttttag |
39392037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Original strand, 45603025 - 45603064
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
45603025 |
agtcatcttatcacaatagttatccttttacatgttttag |
45603064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Original strand, 46487310 - 46487349
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
46487310 |
agtcttcttctcacaatagttatcattttatatgttttag |
46487349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000006; HSPs: 12)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 30609734 - 30609695
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30609734 |
agtcttcttctcacaatagttatcattttacatgttttag |
30609695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 30757232 - 30757193
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30757232 |
agtcctcttctcacaatagttatccttttacatgttttag |
30757193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 416 - 450
Target Start/End: Complemental strand, 28107531 - 28107497
Alignment:
| Q |
416 |
tcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
28107531 |
tcttctcacaatagttatccttttacatgttttag |
28107497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 416 - 450
Target Start/End: Complemental strand, 37060122 - 37060088
Alignment:
| Q |
416 |
tcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37060122 |
tcttctcacaatagttatccttttacatgttttag |
37060088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Original strand, 14786275 - 14786314
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14786275 |
agtcctcttctcacaatagttatcctattacatgttttag |
14786314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Original strand, 21423406 - 21423445
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
21423406 |
agtcttcatctcacaatagttatcctattacatgttttag |
21423445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Original strand, 27004490 - 27004529
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27004490 |
agtcctcttctcacaatagttatccttttatatgttttag |
27004529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 416 - 450
Target Start/End: Original strand, 4382253 - 4382287
Alignment:
| Q |
416 |
tcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4382253 |
tcttctcacaatagttatcattttacatgttttag |
4382287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 416 - 450
Target Start/End: Complemental strand, 6974560 - 6974526
Alignment:
| Q |
416 |
tcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6974560 |
tcttctcacaatagttatcattttacatgttttag |
6974526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 413 - 450
Target Start/End: Complemental strand, 24475978 - 24475941
Alignment:
| Q |
413 |
tcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
24475978 |
tcttcttatcacaatagttatctttttacatgttttag |
24475941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 416 - 448
Target Start/End: Complemental strand, 15070433 - 15070401
Alignment:
| Q |
416 |
tcttctcacaatagttatccttttacatgtttt |
448 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
15070433 |
tcttctcacaatagttatccttttatatgtttt |
15070401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 417 - 449
Target Start/End: Original strand, 27969534 - 27969566
Alignment:
| Q |
417 |
cttctcacaatagttatccttttacatgtttta |
449 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
27969534 |
cttctcacaatagttatccttttatatgtttta |
27969566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000009; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 417 - 450
Target Start/End: Complemental strand, 38451081 - 38451048
Alignment:
| Q |
417 |
cttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38451081 |
cttctcacaatagttatccttttacatgttttag |
38451048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 3729381 - 3729342
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3729381 |
agtcctcttctcacaataattatccttttacatgttttag |
3729342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 8159118 - 8159079
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8159118 |
agtcctcttctcacaataattatccttttacatgttttag |
8159079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 34766932 - 34766893
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
34766932 |
agtcctcttctcacaatagttattcttttacatgttttag |
34766893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 39508364 - 39508325
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
39508364 |
agtctttttctcacaatagttattcttttacatgttttag |
39508325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Original strand, 67913 - 67952
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
67913 |
agtcctcttctaacaatagttatccttttacatgttttag |
67952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.00000001; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Original strand, 444562 - 444601
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
444562 |
agtcctcttctcacaatagttatcctattacatgttttag |
444601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 2814938 - 2814899
Alignment:
| Q |
411 |
agtcttcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2814938 |
agtcctcttctcacaatagttatcattttacatgttttag |
2814899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 416 - 450
Target Start/End: Complemental strand, 6200205 - 6200171
Alignment:
| Q |
416 |
tcttctcacaatagttatccttttacatgttttag |
450 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
6200205 |
tcttctcacaatagttatccttttacatattttag |
6200171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University