View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13357_low_24 (Length: 205)

Name: NF13357_low_24
Description: NF13357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13357_low_24
NF13357_low_24
[»] chr4 (1 HSPs)
chr4 (18-194)||(52565227-52565403)


Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 18 - 194
Target Start/End: Complemental strand, 52565403 - 52565227
Alignment:
18 ccttgtggtgacagtggttgcttttgatcttcaaacttaatctgcttagagttgcttgttaagttagaactgcccgtttgatcagaaatcatcatcttct 117  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
52565403 ccttgtggtgacagtggttgcttttgatcttcaaacttaatctgtttagagttgcttgttaagttagaactgcccgtttgatcagaaaccatcatcttct 52565304  T
118 tcattattctcatctttgaagacatccacttcaccgaagtaccatcctgatcagcttcttgattgttattcatttca 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52565303 tcattattctcatctttgaagacatccacttcaccgaagtaccatcctgatcagcttcttgattgttattcatttca 52565227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University