View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13358_low_6 (Length: 384)
Name: NF13358_low_6
Description: NF13358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13358_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 13 - 366
Target Start/End: Complemental strand, 1591327 - 1590976
Alignment:
| Q |
13 |
catcaaaattaaaccacaaaaagatactctctctctatcaaaataaacccatggtgcaagccctagggtcaccccatatcatatgtaatgtaatcacatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1591327 |
catcaaaattaaaccacaaaaagatactctctct--atcaaaataaacccatggtgcaagccctagggtcaccccatatcatatgtaatgtaatcacatt |
1591230 |
T |
 |
| Q |
113 |
ataaaaaacgctatgcccc-acaaaactatagattctatatgccaaagtgaaacatgcagcatatacatcactttcaattcttccacttcaaa-caaaga |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1591229 |
ataaaaaacgctatgcccccacaaaactatagattctatatgccaaagtgaaacatgcagcatatacatcactttcaattcttccacttcaaaacaaaga |
1591130 |
T |
 |
| Q |
211 |
gtattttcctcttgttttattttagcctcgtatccacttttgacacatatatataccccttcataccctctcataattcctcatccaaaaccagaagaaa |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1591129 |
gtattttcctcttgttttattttagcctcgtatccacttttgacacatatatataccccttcataccctctcataattcctcatccaaaaccagaagaaa |
1591030 |
T |
 |
| Q |
311 |
gnnnnnnnnttcattcattttcaatctcacttctctcttcttctcttgtgctatat |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1591029 |
--aaaaaaattcattcattttcaatctcacttctctcttcttctcttgtgctatat |
1590976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University