View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1335_high_10 (Length: 444)
Name: NF1335_high_10
Description: NF1335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1335_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 97 - 432
Target Start/End: Complemental strand, 29607246 - 29606899
Alignment:
| Q |
97 |
ctggtgacggtccttcatctgaactcattgtagtattatcatcagccagtggtgctgggggactcctcctaatgattgttgaacttgaacttgtaggctc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607246 |
ctggtgacggtccttcatctgaactcattgtagtattatcatcagccagtggtgctgggggactcctcctaatgattgttgaacttgaacttgtaggctc |
29607147 |
T |
 |
| Q |
197 |
tggtgctagagctagtgcgtgatgtttcttatgcttactatgcttgtgttttcttctcttgtgcttgtggggtggcggtggttctggcgcatcatcttca |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607146 |
tggtgctagagctagtgcgtgatgtttcttatgcttactatgcttgtgttttcttctcttgtgcttgtggggtggcggtggttctggcgcatcatcttca |
29607047 |
T |
 |
| Q |
297 |
ggcgatggtgct------------ggtgtgtctattgcaggtgttggtgcaggtgatggtgggagaattgctggggaaggaacaggtgatgattttggtg |
384 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607046 |
ggcgatggtgctggtgctgatgatggtgtgtctattgcaggtgttggtgcaggtgatggtgggagaattgctggggaaggaacaggtgatgattttggtg |
29606947 |
T |
 |
| Q |
385 |
ctttcttctttttgtgtgtaggtgctggtgccggtgtttctgtgtctg |
432 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29606946 |
ctttcttctttttgtgtgtaggtgctggtgccggtgtttctttgtctg |
29606899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University