View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1335_high_21 (Length: 262)
Name: NF1335_high_21
Description: NF1335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1335_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 7e-98; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 22 - 223
Target Start/End: Complemental strand, 33900696 - 33900494
Alignment:
| Q |
22 |
agagaggggaagacggggaagatgaagag--ggaaattcttcacctattttgaaagcatttttgtagaggatgaaaggaaaatacttacttataactatc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33900696 |
agagaggggaagacggggaagatgaagagagggaaattcttcacctattttgaaagcatttttgtagaggatgaaaggaaaatacttacttataactatc |
33900597 |
T |
 |
| Q |
120 |
attttctttaatttgattgaaagtaaagagacgaggaagtagaaggttgtagcaaagtggacaacgggcaaagctttaccacacatcatagttccgtaca |
219 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33900596 |
attt-ctttaatttgattgaaagtaaagagacgaggaagtagaaggttgtagcaaagtggacaacgtgcaaagctttaccacacatcatagttccgtaca |
33900498 |
T |
 |
| Q |
220 |
tatt |
223 |
Q |
| |
|
|||| |
|
|
| T |
33900497 |
tatt |
33900494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 22 - 135
Target Start/End: Original strand, 29057329 - 29057440
Alignment:
| Q |
22 |
agagaggggaagacggggaagatga-agagggaaattcttcacctattttgaaa-gcatttttgtagaggatgaaaggaaaatacttacttataactatc |
119 |
Q |
| |
|
||||| ||||||| || |||||||| |||||||| |||||||||||||| |||| ||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
29057329 |
agagaagggaagaaggtgaagatgagagagggaatttcttcacctatttcgaaaagcatttttgcagaggatgaaaggaaaa----tacttataactatc |
29057424 |
T |
 |
| Q |
120 |
attttctttaatttga |
135 |
Q |
| |
|
||||| |||| ||||| |
|
|
| T |
29057425 |
attttgtttagtttga |
29057440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 47 - 100
Target Start/End: Original strand, 29052791 - 29052844
Alignment:
| Q |
47 |
agagggaaattcttcacctattttgaaagcatttttgtagaggatgaaaggaaa |
100 |
Q |
| |
|
|||||||||| | |||||||||| |||| ||||||| |||||||||||||||| |
|
|
| T |
29052791 |
agagggaaatattgcacctattttcaaagtatttttgcagaggatgaaaggaaa |
29052844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University