View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1335_low_27 (Length: 332)
Name: NF1335_low_27
Description: NF1335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1335_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 9 - 239
Target Start/End: Original strand, 50789043 - 50789267
Alignment:
| Q |
9 |
agcagagaccagaatcaaggcatgtatgtatgtagagatattaacatctaagacttcttagaagtgtacaannnnnnnnnagctaaaacatgatataaaa |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50789043 |
agcagaaaccagaatcaaggcatgtatgtaa----agatattaacatctaagacttcttagaagtgtacaattttttt--agctaaaacatgatataaaa |
50789136 |
T |
|
| Q |
109 |
atcactgtcaaaatgcagaaaatttgagaccattctaaatttaatttaatatgaatcgaaagcaaaaatccacttccaaggtttgaaacaacaaagttca |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50789137 |
atcactgtcaaaatgcagaatatttgagaccattctaaatttaatttaatatgaatcgaaagcaaaaatccacttccaaggtttgaaacaacaaagttca |
50789236 |
T |
|
| Q |
209 |
gtttttcagctcaacgcgtaaagtacaaaat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
50789237 |
gtttttcagctcaacgcgtaaagtacaaaat |
50789267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 261 - 298
Target Start/End: Original strand, 50789726 - 50789763
Alignment:
| Q |
261 |
aatttgggaccaaataacttacaacatttgccaaattt |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50789726 |
aatttgggaccaaataacttacaacatttgccaaattt |
50789763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University