View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1335_low_31 (Length: 325)
Name: NF1335_low_31
Description: NF1335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1335_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 6e-74; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 88 - 228
Target Start/End: Complemental strand, 4235602 - 4235462
Alignment:
| Q |
88 |
ttctctatagaagaactatttgttttttgggatatcattaacatgggtaatgtgttggccttgaattgatgattttgatggttaaactttgcaattgatc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4235602 |
ttctctatagaagaactatttgttttttgggatatcattaacatgggtaatgtgttggccttgaattgatgattttgatggttaaactttgcaattgatc |
4235503 |
T |
|
| Q |
188 |
gccaactcttgcacacagcaccaaaccaaacatgatatatg |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4235502 |
gccaactcttgcacacagcaccaaaccaaacatgatatatg |
4235462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 118 - 220
Target Start/End: Complemental strand, 49145165 - 49145063
Alignment:
| Q |
118 |
gatatcattaacatgggtaatgtgttggccttgaattgatgattttgatggttaaactttgcaattgatcgccaactcttgcacacagcaccaaaccaaa |
217 |
Q |
| |
|
|||||||||| |||||||| || |||| |||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
49145165 |
gatatcattagcatgggtagtgcattggtcttgaattgatgattttgatggctaaactttgcaattgatcgccaagtcttgcacacagcaccaaacgaaa |
49145066 |
T |
|
| Q |
218 |
cat |
220 |
Q |
| |
|
||| |
|
|
| T |
49145065 |
cat |
49145063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 162 - 228
Target Start/End: Complemental strand, 49149668 - 49149602
Alignment:
| Q |
162 |
ttgatggttaaactttgcaattgatcgccaactcttgcacacagcaccaaaccaaacatgatatatg |
228 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49149668 |
ttgatggttaagctttgcaattgatcgccaactcttgcacacagcaccaaaccaaacatgatctatg |
49149602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 157 - 223
Target Start/End: Original strand, 35625842 - 35625908
Alignment:
| Q |
157 |
tgattttgatggttaaactttgcaattgatcgccaactcttgcacacagcaccaaaccaaacatgat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| ||||| ||||||||||||| |
|
|
| T |
35625842 |
tgattttgatggttaaactttgcaattgatcgccagttcttgcacacggcaccgaaccaaacatgat |
35625908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 3e-17; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 151 - 228
Target Start/End: Complemental strand, 29269909 - 29269832
Alignment:
| Q |
151 |
aattgatgattttgatggttaaactttgcaattgatcgccaactcttgcacacagcaccaaaccaaacatgatatatg |
228 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||| | |||||||||||||| ||||||||| |||||||| |||| |
|
|
| T |
29269909 |
aattgatgatttttatggttaagctttgcaattgataggcaactcttgcacaccacaccaaacctaacatgatctatg |
29269832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 151 - 223
Target Start/End: Complemental strand, 28621364 - 28621292
Alignment:
| Q |
151 |
aattgatgattttgatggttaaactttgcaattgatcgccaactcttgcacacagcaccaaaccaaacatgat |
223 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||| |||||| | |||||||| ||||||||| |||||||| |
|
|
| T |
28621364 |
aattgatgattttgatggttcaactttgcaactgaacgccaatttttgcacacgacaccaaacctaacatgat |
28621292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 151 - 228
Target Start/End: Complemental strand, 28614765 - 28614688
Alignment:
| Q |
151 |
aattgatgattttgatggttaaactttgcaattgatcgccaactcttgcacacagcaccaaaccaaacatgatatatg |
228 |
Q |
| |
|
|||||||| ||||||||||||| |||||||| |||||||||| |||||||||| ||| |||| |||||||| |||| |
|
|
| T |
28614765 |
aattgatggttttgatggttaagctttgcaactgatcgccaagtcttgcacacgacactgaacctaacatgatctatg |
28614688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 151 - 228
Target Start/End: Original strand, 28612936 - 28613013
Alignment:
| Q |
151 |
aattgatgattttgatggttaaactttgcaattgatcgccaactcttgcacacagcaccaaaccaaacatgatatatg |
228 |
Q |
| |
|
|||||||| |||||||||||| |||||||| |||| ||||| |||||||||| || |||||| |||||||| |||| |
|
|
| T |
28612936 |
aattgatggctttgatggttaagctttgcaactgatagccaagtcttgcacacgacagcaaacctaacatgatctatg |
28613013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 151 - 220
Target Start/End: Complemental strand, 29287742 - 29287673
Alignment:
| Q |
151 |
aattgatgattttgatggttaaactttgcaattgatcgccaactcttgcacacagcaccaaaccaaacat |
220 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||||||| ||||| |||| ||||| ||||||||| ||||| |
|
|
| T |
29287742 |
aattgatgatttttatggttaagcttagcaattgatagccaattcttacacaccacaccaaacctaacat |
29287673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University