View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1335_low_34 (Length: 312)
Name: NF1335_low_34
Description: NF1335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1335_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 31 - 306
Target Start/End: Complemental strand, 29607460 - 29607185
Alignment:
| Q |
31 |
tgcaccattctgtgaaacataaaatcataagattcgataaaagaagctttagcaagttttgccaagtcagagtacaatctgtctgataaagatcagatga |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607460 |
tgcaccattctgtgaaacataaaatcataagattcgataaaagaagctttagcaagttttgccaagtcagagtacaatctgtctgataaagatcagatga |
29607361 |
T |
 |
| Q |
131 |
caaagattgcatgaattcgttaatgcggcataatccagaccaaagaggtccgtaaatatagaattgtaacttaaagtaaaatggaaaaggatattaccgc |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29607360 |
caaagattgcatgaattcgttaatgcggcatgatccagaccaaagaggtccgtaaatatagaattgtaacttaaagtaaaatggaaaaagatattaccgc |
29607261 |
T |
 |
| Q |
231 |
actgggactgggtgctggtgacggtccttcatctgaactcattgtagtattatcatcagccagtggtgctggggga |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607260 |
actgggactgggtgctggtgacggtccttcatctgaactcattgtagtattatcatcagccagtggtgctggggga |
29607185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University