View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1335_low_35 (Length: 297)
Name: NF1335_low_35
Description: NF1335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1335_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 4e-72; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 10982253 - 10982116
Alignment:
| Q |
1 |
gggacaaaggtctctgctatattcttttacacgactccaaccccaaatcttgcttcaagcattcaaactattgcccacttaatcctatgcttgcagttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10982253 |
gggacaaaggtctctgctatattcttttacacgactccaaccccaaatcttgcttcaagcattcaaactattgcccacttaatcctatgcttgcagttga |
10982154 |
T |
|
| Q |
101 |
accaagacattatttttcatcccctagagaacctagat |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10982153 |
accaagacattatttttcatcccctagagaacctagat |
10982116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 230
Target Start/End: Complemental strand, 10982100 - 10982050
Alignment:
| Q |
180 |
gatatttggtaaattgattaggctagaggtccattatcagcatgttttatg |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
10982100 |
gatatttggtaaattgattaggctagaggtccattatcaacatgtcttatg |
10982050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 286
Target Start/End: Complemental strand, 10982040 - 10982010
Alignment:
| Q |
256 |
ccccacacgaccatcctatcctgtcttctct |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10982040 |
ccccacacgaccatcctatcctgtcttctct |
10982010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University