View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1335_low_47 (Length: 252)

Name: NF1335_low_47
Description: NF1335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1335_low_47
NF1335_low_47
[»] chr7 (1 HSPs)
chr7 (1-223)||(36964652-36964874)


Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 36964652 - 36964874
Alignment:
1 gtttttatcttcagtgaagtctgtggaggatcattctgttcaagttgaacctgctaaagcagcaactttagatatatt-attgggaagaaagttcgtatt 99  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||    
36964652 gtttttatcttcagtgaagtctgtggaggatcattctgttcaagttgaacctgctaaagcagcaactttagatatattgattgggaagaaacttcgtatt 36964751  T
100 aaatggtcagagcttgccgagattactgattatgaccctgccacggtgatatatttaactcgaaatttatagctgttaaaatcccttttcagattgatat 199  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36964752 aaatggtcagagcttgccgagattactgattatgaccctgcc-cggtgatatatttaactcgaaatttatagctgttaaaatcccttttcagattgatat 36964850  T
200 gtctaaatattttcacatgtaaaa 223  Q
    ||||||||||||||||||||||||    
36964851 gtctaaatattttcacatgtaaaa 36964874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University