View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1335_low_47 (Length: 252)
Name: NF1335_low_47
Description: NF1335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1335_low_47 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 36964652 - 36964874
Alignment:
| Q |
1 |
gtttttatcttcagtgaagtctgtggaggatcattctgttcaagttgaacctgctaaagcagcaactttagatatatt-attgggaagaaagttcgtatt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
36964652 |
gtttttatcttcagtgaagtctgtggaggatcattctgttcaagttgaacctgctaaagcagcaactttagatatattgattgggaagaaacttcgtatt |
36964751 |
T |
|
| Q |
100 |
aaatggtcagagcttgccgagattactgattatgaccctgccacggtgatatatttaactcgaaatttatagctgttaaaatcccttttcagattgatat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36964752 |
aaatggtcagagcttgccgagattactgattatgaccctgcc-cggtgatatatttaactcgaaatttatagctgttaaaatcccttttcagattgatat |
36964850 |
T |
|
| Q |
200 |
gtctaaatattttcacatgtaaaa |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36964851 |
gtctaaatattttcacatgtaaaa |
36964874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University