View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1335_low_49 (Length: 251)
Name: NF1335_low_49
Description: NF1335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1335_low_49 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 36965108 - 36965351
Alignment:
| Q |
1 |
aattccatgttttgttgaatatagtaacccagcaacttattaaggtttagctgttacattttgattaaagctgcagtgaaaaatatgtcatcaaaggaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36965108 |
aattccatgttttgttgaatatagtaaaccagcaacttattaaggtttagctgttacattttgattaaagctgcagtgaaaaatatgtcatcaaaggaaa |
36965207 |
T |
|
| Q |
101 |
caactaaactaaatcatgtcttccttcattctttacctc---tcataattgcctaactagaccaaatcttttgatctaatgcaatgcaacccatatcttc |
197 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36965208 |
caactaaactaaatcatgtcttccttctttctttacctctcatcataattgcctaactagaccaaatcttttgatctaatgcaatgcaacccatatcttc |
36965307 |
T |
|
| Q |
198 |
tgtcaaataccattttctccccatttacccgacattttcctttg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36965308 |
tgtcaaataccattttctccccatttacccgacattttcctttg |
36965351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University