View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1335_low_65 (Length: 208)
Name: NF1335_low_65
Description: NF1335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1335_low_65 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 44142035 - 44141896
Alignment:
| Q |
1 |
tcatatcttctcaacttatttctgcaaaatgtaatccaaaagttaaatgtggttatatagtgcagatcgcattttctc----aacaaaacnnnnnnnnca |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |||| || |
|
|
| T |
44142035 |
tcatatcttctcaacttatttctgcaaaatgtaatccaaaagttaaatgtggttatatagtgcagatcacattttctcaaaaaaaaaaaaaaaaaaaaca |
44141936 |
T |
 |
| Q |
97 |
ttaatggttgtataagatataacctcaggctcctatgata |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44141935 |
ttaatggttgtataagatataacctcaggctcctttgata |
44141896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 77; Significance: 6e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 50062613 - 50062529
Alignment:
| Q |
1 |
tcatatcttctcaacttatttctgcaaaatgtaatccaaaagttaaatgtggttatatagtgcagatcgcattttctcaacaaaa |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
50062613 |
tcatatcttctcaacttatttctgcaaaatgtaatccaaaagttaaatgtggttatatagtgtagatcgcattttctcaaaaaaa |
50062529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 97 - 136
Target Start/End: Complemental strand, 50062512 - 50062473
Alignment:
| Q |
97 |
ttaatggttgtataagatataacctcaggctcctatgata |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
50062512 |
ttaatggttgtataagatataacctcaggctcctttgata |
50062473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University