View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1335_low_66 (Length: 204)
Name: NF1335_low_66
Description: NF1335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1335_low_66 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 28 - 172
Target Start/End: Original strand, 28586301 - 28586441
Alignment:
| Q |
28 |
agctaatataaaaaagggaattataaaaggcaatctcaaattctcaattgattttatttgacactaatgaacataccaaaatgtattttttatgagttat |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28586301 |
agctaatataaaaaagggaattataaaaggcaatctcaaattctcaattgattttatttgacact-atgaacataccaaaatgtattttttatgagtta- |
28586398 |
T |
 |
| Q |
128 |
ataatacaatcatctttttcgataacagaagtttcaagcaatgtt |
172 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28586399 |
--aatacactcatctttttcgataacagaagtttcaagcaatgtt |
28586441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University