View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13360_low_10 (Length: 268)
Name: NF13360_low_10
Description: NF13360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13360_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 265
Target Start/End: Original strand, 31114127 - 31114374
Alignment:
| Q |
18 |
cttcactcgttgggtttattatgaacatcatccaaattttgatttatgtaagcttgtgttacattaaacaaatttcatgcattattgaatacatacgacg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31114127 |
cttcactcgttgggtttattatgaacatcatccaaattttgattaatgtaagcttgtgttacattaaacaaatttcatgcattattgaatacatacgacg |
31114226 |
T |
|
| Q |
118 |
ctgatagaaaacaacaaaaattgagagaaaatatatcgtgtaggaggaacttcgcaaagctctatcattcttcttccacttcctcaagttcaaacaaaca |
217 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31114227 |
ctgatagaaaacaacaaaaattgggagaaaatatatcgtgtaggaggaacttcgcaaagctctatcattcttcttccacttcctcaagttcaaacaaacg |
31114326 |
T |
|
| Q |
218 |
ccactgacacggtggccgctgacagtagatactctcaacaacttctcc |
265 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31114327 |
ccactgacacagtggccgctgacagtagatactctcaacaacttctcc |
31114374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University