View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13360_low_12 (Length: 202)
Name: NF13360_low_12
Description: NF13360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13360_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 47 - 185
Target Start/End: Original strand, 29092565 - 29092697
Alignment:
| Q |
47 |
tatcaattggattcccttatgagaaggttcagcaagacagttcttcttcaagttttatcttgccctttcaacttcaagtgacaatttttctcttagttgc |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29092565 |
tatcaattggattcccttatgagaaggttcagcaagacagttcttcttcaagtattatcttgccct------ttcaagtgacaatttttctcttagttgc |
29092658 |
T |
 |
| Q |
147 |
cacaatctctatgttagtaccaaagacatgggcactgat |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29092659 |
cacaatctctatgttagtaccaaagacatgggcactgat |
29092697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University