View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13361_low_7 (Length: 369)
Name: NF13361_low_7
Description: NF13361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13361_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 4 - 353
Target Start/End: Complemental strand, 43339808 - 43339459
Alignment:
| Q |
4 |
acaacattgtcggtgaacatctcttattacttcccttctccgcaattccactctagctggcagcctgctccaaatctgcgaagctgctgccacaataatc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43339808 |
acaacattgtcggtgaacatctcttattacttcccttctccgcaattccactctagttggcagcctgctccaaatctgcgaagctgctgccacaataatc |
43339709 |
T |
 |
| Q |
104 |
ttcatcatattcagcatcacggaacaaatttgacagcaccaaatagaannnnnnnncaccaagaaccctgctccttcgtcgggcagccagcagaaggtat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43339708 |
ttcatcatattcagcatcacggaacaaatttgacagcaccaaatagaattttttttcaccaagaaccctgctccttcgtcgggcagccagcagaaggtat |
43339609 |
T |
 |
| Q |
204 |
cagaaacagatggtcgcggctgcacctgcagaatttcctactgcaaaacagatggtccggttgcaaatttttggaccaattccatctccaaatccacata |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43339608 |
cagaaacagatggtcgcggctgcacctgcagaatttcctactgcaaaacagatggtccggttgcaaatttttggaccaattccatctccaaatccacata |
43339509 |
T |
 |
| Q |
304 |
ttatctcaccaacatcccatgtcggacaccttaacatctctgttagaaac |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43339508 |
ttatctcaccaacatcccatgtcggacaccttaacatctctgttagaaac |
43339459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University