View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13362_high_2 (Length: 209)

Name: NF13362_high_2
Description: NF13362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13362_high_2
NF13362_high_2
[»] chr3 (1 HSPs)
chr3 (17-196)||(47045095-47045273)


Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 196
Target Start/End: Original strand, 47045095 - 47045273
Alignment:
17 catatcatgaatctggcaatagctttgttgtttcaattaaagttgcccaaatatttttggttttatgcaaccacccatgatgattagcatgaaaaattat 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
47045095 catatcatgaatctggcaatagctttgttgtttcaattaaagttgcccaaatatttttggttttatgcaaccacccatgttgattagcatgaaaaattat 47045194  T
117 cctcattgttttgttaaggaagggtataagtagtcaatttcagattactccttgtttaccccttgtgaatggtactgatt 196  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47045195 cctcattg-tttgttaaggaagggtataagtagtcaatttcagattactccttgtttaccccttgtgaatggtactgatt 47045273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University