View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13362_low_2 (Length: 257)
Name: NF13362_low_2
Description: NF13362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13362_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 4 - 240
Target Start/End: Complemental strand, 45593905 - 45593669
Alignment:
| Q |
4 |
atgccagtagctacaaactgaagattgaagatgatatatctggttcagattcaggaaattatgaatttcttgatacttctgattctgcactgaagcacct |
103 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45593905 |
atgccagtagctacaaactgaagcttgaagatgatatatctggttcagattcaggaaattatgaatttcttgatacttctgattctgcactgaagcacct |
45593806 |
T |
|
| Q |
104 |
actgcgtatgcccgatgaaataggtttcctgggacataccgacaatttcttgaatctccttgatggtagatgtgactaagtgcgtgtttggtatcacggt |
203 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45593805 |
actgcgcatgcctgatgaaataggtttcctgggacatactgacaatttcttgaatctccttgatggtagatgtgactaagtgcgtgtttggtatcacaat |
45593706 |
T |
|
| Q |
204 |
gagccatcctgataccaatgctttgacaaaccgtgat |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45593705 |
gagccatcctgataccaatgctttgacaaaccgtgat |
45593669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University