View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13363_high_11 (Length: 252)
Name: NF13363_high_11
Description: NF13363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13363_high_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 26188136 - 26187892
Alignment:
| Q |
1 |
tttaccttttattaacgtatcttaactatattgcatcgcacctgcatccggattacgtattcgtgcttcatactcagaaccgtccaagtgaagaggatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26188136 |
tttaccttttattaacgtatcttaactatattgcatcgcacctgcatccggattacgtattcgtgcttcatactcagaaccgtccaagtgaagaggatgt |
26188037 |
T |
 |
| Q |
101 |
agaatctagaaaacactttgtataattgttttgttttgagactacgagttagagtcagtcaatggataaagatgaaatatgtgatttggaatagatcaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26188036 |
agaatctagaaaacactttgtataattgttttgttttgagacgacgagttagagtcagtcaatggataaagatgaaatatgtgatttggaatagatcaat |
26187937 |
T |
 |
| Q |
201 |
ggccgggttagatacgtatgaggagacttgagatattcttcgaca |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
26187936 |
ggccgggttagatacgtatgaggagacttgagatatacttggaca |
26187892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University