View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13363_high_9 (Length: 266)
Name: NF13363_high_9
Description: NF13363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13363_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 41 - 259
Target Start/End: Original strand, 9537074 - 9537292
Alignment:
| Q |
41 |
tataacaattactctgtttggattcagagcctcacatggtatagataagtcaattaataataaaatacttcacgtgaaaggtaaattacaaatgcatgga |
140 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9537074 |
tataacgattactctgtttggattcagagcctcacatggtatagataagtcaattaataataaaatacttcacgtgaaaggtaaattacaaatgcatgga |
9537173 |
T |
 |
| Q |
141 |
gttgaagatttagatgcatattgcatatgatgatactataggacaaatttaaaggattaaagatagaagaaaatgacacctgtatatagtttaaaagctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9537174 |
gttgaagatttagatgcatattgcatatgatgatactataggacaaatttaaaggattaaagatagaagaaaatgacacctgtatatagtttaaaagctg |
9537273 |
T |
 |
| Q |
241 |
ttgggagactcctttgctt |
259 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
9537274 |
ttgggagactcctttgctt |
9537292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University