View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13364_high_8 (Length: 276)
Name: NF13364_high_8
Description: NF13364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13364_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 928932 - 928717
Alignment:
| Q |
1 |
aatcaattatattgtattggaatcaaaatcatatgatatgataatgtttcactatttgaccctannnnnnnaacattgatttggatcccaataaacacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
928932 |
aatcaattatattgtattggaatcaaaatcatatgata-----atgtttcactatttaaccctatttttttaacattgatttggatcccattaaacacat |
928838 |
T |
|
| Q |
101 |
agtcaagtcaagtcaaacatggtagacacacaccgacagaaagcaatcttggaatccccttaatacccttttcttgcttgatcccatgttccatgttcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
928837 |
agtcaagtcaagtcaaacatggtagacacacaccgacagaaagcaatcttggaatccccttaatacccttttcttgcttgatcccatgttccatgttcca |
928738 |
T |
|
| Q |
201 |
tgtaacttcctttcattctag |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
928737 |
tgtaacttcctttcattctag |
928717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University