View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13364_low_13 (Length: 212)
Name: NF13364_low_13
Description: NF13364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13364_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 23 - 165
Target Start/End: Complemental strand, 2495024 - 2494879
Alignment:
| Q |
23 |
atagcaccaaccatattaacagcatctacaacaaccttaactaaatcaccagaacaaca---tgaaactgaaacacccacaacaaaattcacaacctcaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2495024 |
atagcaccaaccatattaacagcatctacaacaaccttaactaaatcaccagaacaacaacatgaaactgaaacacccacaacaaaattcacaacctcaa |
2494925 |
T |
|
| Q |
120 |
caaccccaaaaatctcacctttttcaaatggtgttctcaaacgttt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2494924 |
caaccccaaaaatctcacctttttcaaatggtgttctcaaacgttt |
2494879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University