View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13364_low_8 (Length: 296)
Name: NF13364_low_8
Description: NF13364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13364_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 20 - 286
Target Start/End: Complemental strand, 26897668 - 26897402
Alignment:
| Q |
20 |
atggaccacttttttagtgttgtatattaaattaaacttatcactcagtgttctacttgaagaaattgtctaataatactaaggtgtaaactgatgtatc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26897668 |
atggaccacttttttagtgttgtatattaaattaaacttatcactcagtattctacttgaagaaattgtctaataatactatggtgtaaactgatgtatc |
26897569 |
T |
|
| Q |
120 |
atgaagttaatctgtatggtataatttccaatctaaaatgaactggtcatataatatcataatctttttggtaagcaaacgcatttgttgatgatgctct |
219 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26897568 |
atgaagttaatctgtatggtataatttcctatctaaaatgaactggtcatatgatatcataatctttttggtaagcaaacacatttgttgatgatgctct |
26897469 |
T |
|
| Q |
220 |
tgttgtttatggtagggagttggtggcattgttgaattggcgcctggttacttgcctgctgcctatg |
286 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26897468 |
tgttgtttatgatagggagttggtggcattgttgaattggcgcctggttacttgcctgctgcctatg |
26897402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University