View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13365_low_4 (Length: 249)
Name: NF13365_low_4
Description: NF13365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13365_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 32706592 - 32706355
Alignment:
| Q |
1 |
ttaggtggtagatatttgtgactccctagactccaagacataattattaaatttatgataatacttcaattgatagtgcattacagattctatgatccaa |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32706592 |
ttaggtggtagatatgtgtgactccctagactccaagacataattattaaatttatgataatacttcaattgacagtgcattacagattctatgatccaa |
32706493 |
T |
 |
| Q |
101 |
tatgggtgtatttctctcaaaagaaactacatcgtgtagttctctctaatgatattgtactacgcctcataactcaatttttggtgtatttctctcaagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32706492 |
tatgggtgtatttctctcaaaagaaactacaccgtgtagttctctctaatgatattgtactacgcctcataactcaattttgggtgtatttctctcaagt |
32706393 |
T |
 |
| Q |
201 |
gatacgatatcttgttgtcacttctctcaagtgatatt |
238 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
32706392 |
gatacgatatcttgtggtcacttctttcaagtgatatt |
32706355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 71 - 119
Target Start/End: Complemental strand, 17556957 - 17556909
Alignment:
| Q |
71 |
tgatagtgcattacagattctatgatccaatatgggtgtatttctctca |
119 |
Q |
| |
|
||||| |||| |||| ||| |||||||||||||||||||| |||||||| |
|
|
| T |
17556957 |
tgatattgcactacaaattttatgatccaatatgggtgtacttctctca |
17556909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University