View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13366_high_39 (Length: 229)
Name: NF13366_high_39
Description: NF13366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13366_high_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 5e-46; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 102 - 211
Target Start/End: Complemental strand, 13447913 - 13447805
Alignment:
| Q |
102 |
cacaatacctgccacaagtactctcaaatcaatgaagtaacatttagctactctggcagatttaacatgaattttcgaatagtttaaacttaattgtttt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13447913 |
cacaatacctgccacaagtactctcaaatcaatgaagtaacatttagctactctggcagatttaacatgaattttcgaatagttt-tccttaattgtttt |
13447815 |
T |
|
| Q |
202 |
gattcaattt |
211 |
Q |
| |
|
|||||||||| |
|
|
| T |
13447814 |
gattcaattt |
13447805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 103 - 186
Target Start/End: Complemental strand, 13454399 - 13454315
Alignment:
| Q |
103 |
acaatacctgccacaagtactctcaaatcaatgaagtaac-atttagctactctggcagatttaacatgaattttcgaatagttt |
186 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||| ||| || ||||||| |||||||||||| ||||||||| ||||||||| |
|
|
| T |
13454399 |
acaatatctgcgacaagtactctcaaatcaatgaagcaacaatatagctaccatggcagatttaatatgaatttttgaatagttt |
13454315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 13448014 - 13447972
Alignment:
| Q |
1 |
tttcctaataacatcgtggtttcgtcaagcggaagtgtgaatg |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13448014 |
tttcctaataacatcgtggtttcgtcaagcggaagtgtgaatg |
13447972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University