View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13366_low_25 (Length: 367)
Name: NF13366_low_25
Description: NF13366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13366_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 13 - 349
Target Start/End: Original strand, 45846400 - 45846736
Alignment:
| Q |
13 |
gagaggattgagtaaccggtaatgttcgcaaagccgacagcgagtgaaccgccggctaaggcaagttcgccgaggtgaccaagaaagagcatggagatca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45846400 |
gagaggattgagtaaccggtaatgttcgcaaagccgaccgcgagtgaaccgccggctaaggcaagttcgccgaggtgaccaagaaagagcatggagatca |
45846499 |
T |
|
| Q |
113 |
ttgaacgacaatagagtaagagaccggtgaaaatcatgggaaaagcaattttggatatagaaataatttctttgaaggtagctctaagatgggttttttg |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45846500 |
ttgaacgacaatagagtaaaagaccggtgaaaatcatgggaaaagcaattttggatatagaaataacttctttgaaggtagctctaagatgggttttttg |
45846599 |
T |
|
| Q |
213 |
gaattgtgttgttggattttctatgtttatgtctttttggataagtggattggtcatcannnnnnnnnnnnnnnnngactcttttgtgtctttgattgaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45846600 |
gaattgtgttgttggattttctatgtttatgtctttttggataagtggattggtcatcatgttgttgttgttgttggactcttttgtgtctttgattgaa |
45846699 |
T |
|
| Q |
313 |
actactagatattcagattttgaattgcatttggaag |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45846700 |
actactagatattcagattttgaattgcatttggaag |
45846736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University