View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13366_low_28 (Length: 344)

Name: NF13366_low_28
Description: NF13366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13366_low_28
NF13366_low_28
[»] chr7 (2 HSPs)
chr7 (1-330)||(39641681-39642010)
chr7 (12-330)||(46669878-46670196)
[»] chr1 (2 HSPs)
chr1 (6-70)||(17091218-17091282)
chr1 (162-267)||(35416015-35416120)


Alignment Details
Target: chr7 (Bit Score: 322; Significance: 0; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 1 - 330
Target Start/End: Complemental strand, 39642010 - 39641681
Alignment:
1 atattttcgggtttgcctttgctttcggcacaccttctaatggtttcattggaaaacattttttcggtcttagtgattttccttctcagtcttttgatta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39642010 atattttcgggtttgcctttgctttcggcacaccttctaatggtttcattggaaaacattttttcggtcttagtgattttccttctcagtcttttgatta 39641911  T
101 tggatattttctatatcaatgggcttttgcaattgctgcagcaggaatcactagtggttcaattgctgagagaacacaatttgtttcttatttgatttat 200  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39641910 tggatattttctatatcaatgggcttttgcaattgcttcagcaggaatcactagtggttcaattgctgagagaacacaatttgtttcttatttgatttat 39641811  T
201 tcttcttttctaacaggtttagtttatccgattgttgctcattggttttggtctgctgatggttggggtagtccggttcggtctgaaaatcttttgtttg 300  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39641810 tcgtcttttctaacaggtttagtttatccgattgttgctcattggttttggtctgctgatggttggggtagtccggttcggtctgaaaatcttttgtttg 39641711  T
301 gttccggtgttattgattttgctggttgtg 330  Q
    ||||||||||||||||||||||||||||||    
39641710 gttccggtgttattgattttgctggttgtg 39641681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 12 - 330
Target Start/End: Complemental strand, 46670196 - 46669878
Alignment:
12 tttgcctttgctttcggcacaccttctaatggtttcattggaaaacattttttcggtcttagtgattttccttctcagtcttttgattatggatattttc 111  Q
    |||||| | ||||| || |||||||| || |||||||| |||||||||||||| ||||||| |||||| ||||| || ||||||||||| || | ||| |    
46670196 tttgccctagcttttggaacaccttcaaacggtttcataggaaaacatttttttggtcttactgatttcccttcacaatcttttgattacggttttttcc 46670097  T
112 tatatcaatgggcttttgcaattgctgcagcaggaatcactagtggttcaattgctgagagaacacaatttgtttcttatttgatttattcttcttttct 211  Q
    | | ||||||||||||||| |||||||||||||| ||||| ||||| |||||||||||||||||||| || |||||||||||||||||||| || ||| |    
46670096 tctttcaatgggcttttgccattgctgcagcagggatcacaagtggatcaattgctgagagaacacagttcgtttcttatttgatttattcgtcgttttt 46669997  T
212 aacaggtttagtttatccgattgttgctcattggttttggtctgctgatggttggggtagtccggttcggtctgaaaatcttttgtttggttccggtgtt 311  Q
    ||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
46669996 aaccggtttagtttatccaattgttgctcattggttttggtctgctgatggttggggtagtccggttcggtctgaaaatcttttgtttggttctggtgtt 46669897  T
312 attgattttgctggttgtg 330  Q
    |||||||||||||||||||    
46669896 attgattttgctggttgtg 46669878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 6 - 70
Target Start/End: Complemental strand, 17091282 - 17091218
Alignment:
6 ttcgggtttgcctttgctttcggcacaccttctaatggtttcattggaaaacattttttcggtct 70  Q
    ||||| ||||||||||| ||||| |||||||| ||||||||||| ||||||||||| ||||||||    
17091282 ttcggttttgcctttgccttcggaacaccttcaaatggtttcataggaaaacatttcttcggtct 17091218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 162 - 267
Target Start/End: Complemental strand, 35416120 - 35416015
Alignment:
162 attgctgagagaacacaatttgtttcttatttgatttattcttcttttctaacaggtttagtttatccgattgttgctcattggttttggtctgctgatg 261  Q
    ||||| |||||||| ||||||||  | ||| | || |||||||||||  |||| ||||| |||||||| || ||| | |||||| ||||||| |||||||    
35416120 attgcagagagaactcaatttgtcgcctatctcatatattcttctttcttaaccggttttgtttatcccatcgtttcgcattgggtttggtccgctgatg 35416021  T
262 gttggg 267  Q
    ||||||    
35416020 gttggg 35416015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University