View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13366_low_34 (Length: 293)
Name: NF13366_low_34
Description: NF13366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13366_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 8e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 148 - 276
Target Start/End: Original strand, 33782475 - 33782603
Alignment:
| Q |
148 |
cggcgggtattgtttgtttgcatggggcgttgaagaggacggatgttggtggtttggatgattatgaatcgccgtatggtcctatgctagctactgatac |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33782475 |
cggcgggtattgtttgtttgcatggggcgttgaagaggacggatgttggtggtttggatgattatgaatcgccgtatggtcctatgctagctactgatac |
33782574 |
T |
 |
| Q |
248 |
tgctggtccttatgcacctgtttgatatt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33782575 |
tgctggtccttatgcacctgtttgatatt |
33782603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 33782328 - 33782384
Alignment:
| Q |
1 |
tctcacgtgactccgatgagcctctgtcgctgttcaacgtcgtggcggttgatgatc |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33782328 |
tctcacgtgactccgatgagcctctgtcgctgttcaacgtcgtggcggttgatgatc |
33782384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University