View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13366_low_35 (Length: 287)
Name: NF13366_low_35
Description: NF13366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13366_low_35 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 287
Target Start/End: Original strand, 45460323 - 45460591
Alignment:
| Q |
19 |
atcaaaaacaatacatggccagatttacatctccgatgtcaactggttattgatgattttcagtctagctgtgacggttggtttcagagacatggtgaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45460323 |
atcaaaaacaatacatggccagatttacatctccgatgtcaactggttattgatgattttcagtctagctgtgacggttggtttcagagacatggtgaag |
45460422 |
T |
 |
| Q |
119 |
attggcaacgcaacaagtatgccannnnnnncatttctcttggtgttaattaatgnnnnnnncttgagttattaatcaagagagtagctcccatttttgc |
218 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45460423 |
attggcaacgcaacaagtatgccatttttttcatttctcttggtgttaattaatgtttttttcttgagttattaatcaagagagtagctcccatttttgc |
45460522 |
T |
 |
| Q |
219 |
attaaactagaaaatgaagagaagtcttnnnnnnntgaaaacttggtaaactaaacagggaatgcagat |
287 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
45460523 |
attaaactagaaaatgaagggaagtcttaaaaaaatgaaaagttggtaaactaaacagggaatgcagat |
45460591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University