View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13366_low_38 (Length: 253)
Name: NF13366_low_38
Description: NF13366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13366_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 22 - 66
Target Start/End: Original strand, 7742421 - 7742465
Alignment:
| Q |
22 |
atgaagatgaagaggatgaaagaggcggcggcggtggaaataagc |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7742421 |
atgaagatgaagaggatgaaagaggcggcggcggtggaaataagc |
7742465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 198 - 250
Target Start/End: Original strand, 40863619 - 40863671
Alignment:
| Q |
198 |
aaggtttctgctttgaatttctttgatgaagaggctgatgttgattctgatga |
250 |
Q |
| |
|
|||||||| |||| ||||||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
40863619 |
aaggtttccgcttcaaatttctttgacgaagaggctgctgttgattcggatga |
40863671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University