View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13366_low_38 (Length: 253)

Name: NF13366_low_38
Description: NF13366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13366_low_38
NF13366_low_38
[»] chr1 (1 HSPs)
chr1 (22-66)||(7742421-7742465)
[»] chr3 (1 HSPs)
chr3 (198-250)||(40863619-40863671)


Alignment Details
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 22 - 66
Target Start/End: Original strand, 7742421 - 7742465
Alignment:
22 atgaagatgaagaggatgaaagaggcggcggcggtggaaataagc 66  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
7742421 atgaagatgaagaggatgaaagaggcggcggcggtggaaataagc 7742465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 198 - 250
Target Start/End: Original strand, 40863619 - 40863671
Alignment:
198 aaggtttctgctttgaatttctttgatgaagaggctgatgttgattctgatga 250  Q
    |||||||| ||||  ||||||||||| |||||||||| ||||||||| |||||    
40863619 aaggtttccgcttcaaatttctttgacgaagaggctgctgttgattcggatga 40863671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University