View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13366_low_44 (Length: 231)
Name: NF13366_low_44
Description: NF13366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13366_low_44 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 16 - 225
Target Start/End: Original strand, 418014 - 418216
Alignment:
| Q |
16 |
atcaactcacaatgataaaagtgttataaaagaaacacttaaaaaggcaattggtgttgtgtgtgtaaacgcgttacatcaacannnnnnnnnnnnnncc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
418014 |
atcaactcacaatgataaaagtgttataaa-gaaacacttaaaaaggcaattggtgttgtgtgtgtaaacgcgttacatcaacatctctctct------c |
418106 |
T |
 |
| Q |
116 |
actcccactcaaggtcatgactcgatgaccatccaggttcccaccaaacactcttgttgagtatgagaaattagagaaagagaccccatgcaatcaaatg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
418107 |
tctcccactcaaggtcatgactcgatgaccatccaggttcccaccaaacactcttgttgagtatgagaaattagagaaagagaccccatgcaatcaaatg |
418206 |
T |
 |
| Q |
216 |
ccataaaaca |
225 |
Q |
| |
|
|||||||||| |
|
|
| T |
418207 |
ccataaaaca |
418216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University