View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13366_low_46 (Length: 227)
Name: NF13366_low_46
Description: NF13366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13366_low_46 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 7 - 168
Target Start/End: Original strand, 9463062 - 9463224
Alignment:
| Q |
7 |
aaatcggttgtgaaaaagggttgctccaatactttttgaatgaatggtaaacgaagtagacctcctgtcctcttgtcgtactttttcaaaattttagcca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9463062 |
aaatcggttgtgaaaaagggttgctccaatactttttgaatgaatggtaaacgaagtagacctcctgtcctcttgtcatactttttcaaaattttagcca |
9463161 |
T |
|
| Q |
107 |
accctac-nnnnnnntcaatgtgttttggtgattgcttgataatagtgattttgaattgaata |
168 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9463162 |
accctacaaaaaaaatcaatgtgttttggtgattgcttgatacacatgattttgaattgaata |
9463224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University