View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13367_high_7 (Length: 262)
Name: NF13367_high_7
Description: NF13367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13367_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 16 - 245
Target Start/End: Original strand, 15306236 - 15306465
Alignment:
| Q |
16 |
aaaataaaaaactgtctttagatccgaatcatttggtcttgatcggatggtttagaggtgttgactgaccactgactgcatttaatccaagttcatgtta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15306236 |
aaaataaaaaactgtctttagatccgaatcatttggtcttgatcggatggtttagaggtgttgactgaccactgactgcatttaatccaagttcatgtta |
15306335 |
T |
 |
| Q |
116 |
tacctgtgtgttcaatgttgattattgagcttagaattatgattctaatgaagcggaggcaataatgcttggttttcaacattacttggtgatgttgggc |
215 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15306336 |
tacctgcgtgttcaatgttgattgttgagcttagaattatgattctaatgaagcggaggcaataatgcttggttttcaacattacttggtgatgttgggc |
15306435 |
T |
 |
| Q |
216 |
acaactgttttgataccaactgctctagtt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15306436 |
acaactgttttgataccaactgctctagtt |
15306465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University